ФАРМАКОГЕНОМИКА – ПУТЬ К ПЕРСОНАЛИЗИРОВАННОЙ МЕДИЦИНЕ

ИСКАКОВА АЙША НУРБЕКОВНА

бакалавр, младший научный сотрудник, РГП «Национальный центр биотехнологии РК» КН МОН РК, Астана, Казахстан

aishaisk1@gmail.com

РОМАНОВА АЛИЯ АДЕЛОВНА

бакалавр, лаборант, РГП «Национальный центр биотехнологии РК» КН МОН РК, Астана, Казахстан

РАХИМОВА САУЛЕ ЕСЛЯМОВНА

кандидат биологических наук, старший научный сотрудник, РГП «Национальный центр биотехнологии РК» КН МОН РК, Астана, Казахстан

РАМАНКУЛОВ ЕРЛАН МИРХАЙДАРОВИЧ

PhD, генеральный директор, РГП «Национальный центр биотехнологии РК» КН МОН РК, Астана, Казахстан

 

Аннотация

Фармакогеномика – одно из новых направлений современной науки. Результаты фармакогеномических исследований могут быть использованы в развитии персонализированной медицины. Одним из ярких примеров персонализированного подхода к дозированию лекарственного препарата на основе генотипа человека является антикоагулянт непрямого действия – Варфарин.

Ключевые слова: Фармакогеномика, Варфарин, CYP2C9, VKORC1, GGCX, CYP4F2, тромбозы


Введение

На сегодняшний день проблема правильной дозировки лекарственных средств является крайне актуальной для всех стран. Общеизвестно, что многие лекарственные препараты имеют побочные действия, или так называемые, нежелательные лекарственные реакции. Согласно данным Управления по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA, USA) количество случаев возникновения побочных реакций в США на 2009 год возросло до 373, 535 (Рисунок 1). Ситуация в Казахстане не является исключением. Так, согласно данным Национального центра экспертизы лекарственных средств, изделий медицинского назначения и медицинской техники на период с мая 2005 года по февраль 2007 года количество случаев побочных действий от препаратов для лечения ЦНС достигает 38%, от противотуберкулезных препаратов – 21%.

Рисунок 1. Количество случаев возникновения побочных действий лекарств в США (по годам) ("AERS Patient Outcomes by Year" Food and Drug Administration (Washington, DC: U.S. Department of Health and Human Services, March 31, 2010)


ФАРМАКОГЕНОМИКА – ПУТЬ К ПЕРСОНАЛИЗИРОВАННОЙ МЕДИЦИНЕ


Однако не у всех эти нежелательные лекарственные реакции проявляются именно побочными действиями. Часто возникают ситуации, когда препарат не оказывает ожидаемого эффекта на пациента.  Это сейчас мы знаем, что для правильного лечения препаратами, т.е. для «правильной» дозировки необходимо учитывать многие факторы, такие как вес, возраст и др., а в недалеком прошлом «правильная» дозировка лекарственного препарата вызывала огромные затруднения для врачей.


Биотрансформация ксенобиотиков

Биотрансформация ксенобиотиков, к которым относятся и лекарственные средства,  представляет собой принципиальный механизм поддержания гомеостаза во время воздействия на организм чужеродных соединений. В системе биотрансформации принято выделять две фазы метаболизма. К 1-й фазе относятся реакции гидролиза, восстановления и окисления субстрата. Среди ферментов 1-й фазы ведущее место занимает система цитохрома Р450 (P450 или CYP) с точки зрения каталитической активности в отношении огромного числа ксенобиотиков. Наибольшая концентрация цитохрома Р450 обнаруживается в эндоплазматическом ретикулуме гепатоцитов (микросомах). Печеночные микросомальные цитохромы Р450 играют важнейшую роль в определении интенсивности и времени действия чужеродных соединений и ключевую - в детоксикации ксенобиотиков, а также в активации их до токсичных и/или канцерогенных метаболитов.

Ко второй фазе биотрансформации ксенобиотиков (II фаза) относятся реакции глюкуронидации, сульфатирования, ацетилирования, метилирования, конъюгации с глютатионом (синтез меркаптуровой кислоты) и конъюгация с аминокислотами, такими как глицин, таурин, глутаминовая кислота. Кофакторы этих реакций реагируют с функциональными ферментами 1-й фазы. За исключением метилирования и ацетилирования, реакции 2-й фазы приводят к значительному увеличению гидрофильности ксенобиотика, что способствует их экскреции из организма. Большинство ферментов 2-й фазы локализовано в цитозоле, кроме уридиндифосфоглюкуронозилтрансфераз (УДТ), которые являются микросомальными. Реакции 2-й фазы обычно протекают намного быстрее, чем реакции 1-й фазы, катализируемые цитохромом Р-450. Поэтому скорость элиминирования ксенобиотика в большой степени зависит от скорости, с которой протекает реакция 1-й фазы (Райс Р.Х., Гуляева Л.Ф., 2003).


Варфарин – «классический» пример рационализации приема лекарственных средств

Варфарин - антикоагулянт непрямого действия из ряда кумаринов. Это средство, применяемое для лечения и профилактики тромбозов и тромбоэмболий, вызывает ряд побочных эффектов, наиболее тяжелым из которых являются кровотечения различной локализации.

Как выше уже было упомянуто, для расчета оптимальной дозировки лекарственных средств необходимо учитывать такие факторы, как вес, возраст, этическая принадлежность, терапия лекарственными препаратами и генетические особенности. В случае Варфарина, вклад генетических особенностей при расчете дозировок составляет почти 50%. Для того, что бы понять какие гены отвечают за метаболизм Варфарина, необходимо немного разобраться в механизме действия.

При норме в коагуляционном каскаде II, VII, IX, X факторы крови подвергаются γ- глутамил-карбоксилированию, т. е.  при участии фермента γ-глутамил-карбоксилазы (GGCX) данные факторы крови из неактивного состояния переходят в функционально активное.  В результате, происходит снижение витамин К гидроксихинона (VitKH2), так как последний используется в качестве источника протонов реакции карбоксилирования. Побочным продуктом реакции карбоксилирования является витамин К - эпоксид, который при участии фермента VKOR снова превращается в VitKH2, который необходим для формирования активных коагуляционых факторов. Действие Варфарина заключается в ингибировании фермента VKOR, т.е. мультипротеиновый  комплекс  витамин  К эпоксид – редуктазы является молекулой-мишенью Варфарина. Сам же Варфарин метаболизируется ферментами системы цитохромов P 450. Основная  форма S-Варфарина метаболизируется ферментом CYP2C9,  форма R-Варфарина – ферментами CYP1A1, CYP1A2, CYP3A4. Так же имеются сведения об участии в метаболизме Варфарина фермента CYP4F2. Физиологическая роль CYP4F2 в биотрансформации варфарина неизвестна.

Известно, что от определенных полиморфизмов единичного нуклеотида  (single nucleotide polymorphisms, SNP) генов, продуцирующих данные ферменты, зависит активность одноименных ферментов. В зависимости от реакции организма на терапию лекарственными препаратами, т.е. на основании того, как ферменты метаболизируют лекарственное средство, разделяют 4 типа метаболизма лекарственных средств: «медленные метаболизаторы» (poor metabolizer, PM),  «промежуточные метаболизаторы» (intermediate metabolizer, IM), «экстенсивные метаболизаторы» (extensive metabolizer, EM) и в некоторых случаях «сверхактивные метаболизаторы» (ultraextensive, UM). Так, в случае, если у пациента «медленный» метаболизм, то стандартная терапевтическая дозировка Варфарина будет вызывать токсическое действие.  В случае «сверхактивного» метаболизма стандартная терапевтическая дозировка не будет успевать оказывать ожидаемого лечебного эффекта. Для такого пациента необходимо значительно повышать дозировку или подбирать лекарственное средство, метаболизируемое иными ферментами.

То, каким метаболизмом обладает человек можно определить заранее, до приема лекарственных средств, на основании генотипа генов, продуцирующих вышеуказанные ферменты. Установлено, что генами, ассоциированными с дозировкой Варфарина, являются CYP2C9, CYP4F2, GGCX и VKORC1, что вполне согласуется с механизмом действия и биотрансформацией Варфарина.   


Алгоритмы расчета дозировки Варфарина

Существует несколько подходов к расчету оптимальной дозировки Варфарина, основанных на фармакогенетических исследованиях.

На основе генотипа и физикальных характеристик Sconce EA и соавт. (2005) была разработана математическая формула расчета начальной дозы Варфарина, в которой учитывались такие параметры, как возраст, рост и данные генотипирования CYP2C9*2, CYP2C9*3 и VKORC1.


где:

-  CYP2C9 в зависимости от генотипа равен 1 при гетерозиготном носительстве аллельных вариантов соответствующих аллельных вариантов (генотипы CYP2C9*1/*2 или CYP2C9*1/*3), а при гомозиготном носительстве (генотипы CYP2C9*2/*2 или CYP2C9*3/*3) равен 2;

-  показатель VKORC1 (1639 G>А) для GG -1, AG – 2 и АА – 3.

Группой авторов Gage BF (2008) была предложен алгоритм, в котором учитывались такие параметры, как возраст, расовая принадлежность, пол, значение целевого МНО, площадь поверхности тела (исходя из роста и веса), взаимодействие Варфарина с Амиодароном и статинами, и данные генотипирования CYP2C9*2, CYP2C9*3.


 

где:

-                     ППТ = вес (кг) 0.425 × рост (см) 0.725 × 0.007184. Если пациент принимает амиодарон или статин (флувастатин или симвастатин), в формулу подставляется 1, если нет – 0. Тоже касается и совместного применения амиодарона. Если больной относится к европеоидной расе, в формулу необходимо подставить 1,  для представителей других рас - 0; если расчет дозы Варфарина ведется для женщины, необходимо подставить 1, для мужчины – 0 (Сычев Д.А., 2007, с.59-66).

Anderson JL и соавт. (2007) была предложена формула, в которой учитывались возраст, пол, вес и данные генотипирования CYP2C9*2, CYP2C9*3 и VKORC1 для расчета еженедельной дозы.

 

На основании этих и др. исследований на сайте www.warfarindosing.org  был разработан алгоритм расчета дозировки Варфарина, учитывающий все вышеперечисленные параметры.

Более простой алгоритм был предложен М.Moridani и соавт. (2006). Авторы рассчитали средние рекомендованные начальные дозы Варварина для пациентов разных этнических групп и разных патологий в зависимости от результатов фармакогенетического тестирования по CYP2C9 (Рисунок 2). Для получения начальной дозы Варварина вместо Х необходимо подставить *2 или *3, в зависимости от соответствующего выявленного генотипа.

Рисунок 2. Дозы Варфарина в зависимости от результатов фармакогенетического тестирования по CYP2C9


ФАРМАКОГЕНОМИКА – ПУТЬ К ПЕРСОНАЛИЗИРОВАННОЙ МЕДИЦИНЕ


Немного другой подход к дозированию Варфарина предложили Peyvandi F и соавт. (2004). Он заключается в том, что необходимо проводить коррекцию дозировки Варфарина на основе генотипа человека после назначения стандартной дозы.


Материалы и методы

Характеристика исследуемой группы

В исследование были включены 2 группы. В первую группу были включены 450 условно здоровых человек казахской национальности, от которых было получено информированное согласие. Возраст участников составлял от 17 до 70 лет (cредний возраст 40,6 лет). Сбор образцов венозной крови (5 мл) в пробирках с ЭДТА осуществлялся на клинических базах г. Астаны. Каждому образцу и соответствующей ей анкете был присвоен индивидуальный номер. ДНК выделяли из крови с помощью  набора «DNA Purification Kit» (Promega) согласно протоколу производителя.

Во вторую группу были включены 23 пациента казахской национальности с диагнозом инфаркт миокарда в сочетании с мерцательной аритмией, получающих антикоагулянтную терапию Варфарином. Сбор образцов венозной крови (5 мл) в пробирках с ЭДТА осуществлялся на клинических базах г. Семей. Всеми участниками исследования было подписано информационное согласие. ДНК выделяли из крови с помощью  набора «DNA Purification Kit» (Promega) согласно протоколу производителя.


Генотипирование

Генотипирование проводилось методом прямого секвенирования. Фрагменты генов, содержащих области анализируемых полиморфизмов, получали в ходе полимеразной цепной реакции при помощи олигонуклеотидных пар праймеров (Таблица 1). Амплификацию проводили на многоканальном термоциклере "PTC-0240 DNA EngineTetrad2 Cycler" (BioRad, USA). Условия амплификации: денатурация 5 мин при 95°С, следующие 35 циклов 30 сек при 95°С,  отжиг праймеров 30 сек при 50°С для CYP2C9*2/3/5/6,  30 сек при 56°С для VKORC1/GGCX или 30 сек при 60°С для CYP4F2, 72°С 30-45 сек, 72°С – 7 мин, 10°С - ∞. Праймеры, использованные для генотипирования указаны в таблице 1. Идентификацию точечных однонуклеотидных замен проводили на основе ДНК - секвенирования с применением набора “BigDye Terminanor v 3.1  Cycle sequencing Kit (3730XL Genetic Analyzer, фирмы AppliedBiosystems ABI) согласно протоколу производителя. Для анализа данных использовали пакет программ Sequence Scanner v1.0.


Таблица 1

Праймеры, использованные для генотипирования

№ п.п

Аллели

 Полиморфизм единичного нуклеотида

Последовательность праймеров

1

CYP2C9*2

430С>T R144C

TAGTTTCGTTTCTCTTCCTGTTA




AAATGTTTCCAAGAATGTCAGTA

2

CYP2C9*3

1075A>C I135L

CTAAAgTCCAggAAgAgATTgA




ATgATACTATgAATTTggggACT

3

CYP2C9*5

1080C>G D360E

CTAAAgTCCAggAAgAgATTgA




ATgATACTATgAATTTggggACT

4

CYP2C9*6

818delA

frame shift

CAgAgCTTggTATATggTATgTA




TACTgATTgACCAgTTAAACATC

5

VKORC1

1639G>A Promoter

AggAgATTggTCAgCTTAATTCCAT




TAATCATCTggCATCCTggC

6

CYP4F2

1297G>A V433M

AgCggATAACgTgTTTTCggAACCCATCAC




AgCggATAACgCCTTggAATggACAAAAAC

7

GGCX

16025 G>C

gCTTCTTgTTgCgAAAgCTCTAT




CAAACACTTgggAACAgTTAgCT


Статистический анализ

Статистический анализ был проведен с помощью программы SPSS v.16.0. С помощью критерия χ2  было определено соответствие частот встречаемости аллелей закону Харди-Вайнберга.


Результаты

Частоты встречаемости полиморфизмов единичного нуклеотида для группы контроля представлены в таблице 2. Аллели CYP2C9*2, CYP2C9*3, CYP4F2 и GGCX соответствуют равновесию Харди – Вайнберга (p > 0, 05).  Аллели CYP2C9*5, CYP2C9*6 не встречаются в исследуемой группе. Частота встречаемости VKORC1 в казахской популяции значительно отклоняется от равновесия Харди – Вайнберга, однако характерна для частот встречаемости в азиатских популяциях. 


Таблица 2

Частоты встречаемости полиморфизмов единичного нуклеотида в казахской популяции

Полиморфизм

Количество образцов

Соответствие равновесию Харди-Вайнберга

Аллель

na

частота

Генотип

nb

частота

CYP2C9*2

437

p=0,66

C

856

0,98

СС

419

0,96


   

T

18

0,02

СT

18

0,04







TT

0

0,00

CYP2C9*3

444

p=0,54

A

863

0,97

AA

419

0,94


   

C

25

0,03

AC

25

0,06







CC

0

0,00

CYP2C9*5

105

p=0,00

C

210

1,00

СС

105

1,00


   

G

0

0,00

CG

0

0,00







GG

0

0,00

CYP2C9*6

277

p=0,00

A

554

1,00

AA

277

1,00


   

del

0

0,00

A/del

0

0,00


         

del/del

0

0,00

VKORC1

90

p=0,34

G

57

0,315

GG

11

0,122

     

A

123

0,685

GA

35

0,389







AA

44

0,489

CYP4F2

284

p=0,26

G

396

0,70

GG

134

0,47


   

A

172

0,30

GA

128

0,45







AA

22

0,08

GGCX

266

p=0,57

C

514

0,97

CC

248

0,93


   

G

18

0,03

CG

18

0,07







GG

0

0,00


Образцы ДНК пациентов, страдающих ишемической болезнью сердце в сочетании с мерцательной аритмией были так же генотипированы. Частоты встречаемости полиморфизмов единичного нуклеотида не отличались от группы контроля. На основании проведенных исследований выявлено, что наиболее оптимальным алгоритмом подбора дозировки Варфарина для казахской популяции является алгоритм, использованный на сайте www.warfarindosing.org, основанный на уравнениях Anderson JL и  Gage BF.  Этот алгоритм учитывает как фенотипические, так и генетические данные пациента. В группе больных, принимающих варфарин наибольшая поддерживающая доза рассчитана для пациентов моложе 49 лет, ростом выше 175 см и весом свыше 90 кг, тогда как наименьшая доза препарата рекомендована для лиц пожилого возраста (старше 70 лет) и с не очень большим индексом массы тела (рост менее 165 см и вес менее 80 кг) (Рисунок 3).  

Рисунок 3. Дозировка Варфарина и фенотипические данные пациентов


ФАРМАКОГЕНОМИКА – ПУТЬ К ПЕРСОНАЛИЗИРОВАННОЙ МЕДИЦИНЕ



Заключение

Использование методов персонализированной медицины значительно сокращает время подбора оптимальной дозы и количество случаев нежелательных побочных реакций, т.е. повышается качество и уровень жизни пациентов. При активном использовании фармакогенетических методов наряду с огромным социальным эффектом, будет оказываться и значительный экономический эффект. Расчет персональных эффективных доз лекарственных препаратов приводит к  снижению побочных эффектов и экономических расходов, связанных с неоправданным использованием универсальных доз (неоправданный расход лекарственных препаратов при лечении основного заболевания, расход средств на дополнительное лечение от воздействия побочных эффектов, возникших при лечении основного заболевания). Т. е.  грамотный индивидуальный подход к дозированию медикаментов окажет сберегающий эффект на бюджет здравоохранения. Кроме того данные фармакогенетических исследований дают возможность второй жизни препаратов, не прошедших клинические испытания и отозванные с рынка, а также возможность избежать отзыва продаваемых препаратов с рынка.

Из всего вышеизложенного следует, что необходимо наряду с методами «классической» медицины применять и современные молекулярно-генетические методы при определении оптимальной дозировки лекарственного средства, т.е. использовать системы подбора индивидуальных доз лекарственных препаратов. 


Литература

  1. Акильжанова А.Р., Жолдыбаева Е.В., Кожахметова С. С. и др. Генетический паспорт – миф или реальность // Астана медициналык журналы. – 2010. - №4(62). – С. 23-27
  2. Искакова А. Н., Романова А. А., Кожахметова С. С. и др. Полиморфизм  гена GSTP1 в казахской популяции, Биотехнология. Теория и практика, 2011 –  Номер 3, С. 53-57.
  3. Райс Р.Х., Гуляева Л.Ф. Биологические эффекты токсических соединений. Курс лекций. Новосибирск, 2003
  4. Сычев Д.А.,  Антонов И.М., Загребин С.В. и др. Алгоритмы дозирования варфарина, основанные на результатах фармакогенетического тестирования: реальная возможность оптимизации фармакотерапии. РФК 2007; 2:59-66
  5. Anderson JL, Horne BD, Stevens SM et al. Randomized trial of genotype-guided versus standard warfarin dosing in patients initiating oral anticoagulation. Circulation 2007;116:2563-70.
  6. Gage B, Eby C, Johnson J, Deych E et al. Use of Pharmacogenetic and Clinical Factors to Predict the Therapeutic Dose of Warfarin. Clin. Pharmacol. Ther. 2008
  7. Moridani M, Fu L, Selby R, Yun F et al. Frequency of CYP2C9 polymorphisms affecting warfarin metabolismin a large anticoagulant clinic cohort. Clin Biochem. 2006; 39(6): 606-12.
  8. Moyer TP, O’Kane DJ et al. Warfarin Sensitivity Genotyping: A Review of the Literature and Summary of Patient Experience. Mayo. Clin. Proc. December 2009; 84(12):1079-1094
  9. Peyvandi F, Spreafico M, Siboni SM et al. CYP2C9 genotypes and dose requirements during the induction phase of oral anticoagulant therapy. Clin. Pharmacol. Ther. 2004;75(3):198-203.
  10. Roper N, Storer B, Bona R, Fang M. Validation and comparison of pharmacogenetic-based Warfarin dosing algoritms for applications of pharmocogenetic testing. Journal of Mol. Diagostics 2010, Vol.12(3)
  11. Sanderson S, Emery J, Higgins J. CYP2C9 gene variants, drug dose, and bleeding risk in warfarin-treated patients: a HuGEnet systematic review and meta analysis. GenetMed. 2005; 7(2): 97-104.
  12. Schelleman H, Chen J, Chen Zh et al. Dosing algorithms to predict Warfarin maintenance dose in Caucasians and African Americans. Clin. Pharmacol. Ther. 2008; 84(3): 332-339
  13. Sconce EA, Khan TI, Wynne HA, et al. The impact of CYP2C9 and VKORC1 genetic polymorphism and patient characteristics upon warfarin dose requirements: proposal for a new dosing regimen. Blood 2005;106:2329-33.
  14. Takahashi H, Wilkinson GR, Nutescu EA et al. Different contributions of polymorphisms inVKORC1 and CYP2C9 to intra- and inter-population differences in maintenance dose of warfarin in Japanese, Caucasians and African-Americans. Pharmacogenet. Genomics. 2006; 16(2): 101-10.
  15. Ventola CL. Pharmacogenomics in clinical practice. Reality and expectations. P&T 2011; Vol. 36 (7)
  16. http://pharmsuite.ru/web2/    
  17. http://www.warfarindosing.org
  18. http://www.fda.gov/



 

 

 














 


 

 

  .  
 
Copyright (C) Журнал ЛАБОРАТОРНАЯ МЕДИЦИНА,
Республика Казахстан, 050026, г. Алматы, Алмалинский район, ул. Байзакова 125/185 (БЦ Nomad), НП 2, офис 207
Тел.: +7 (727) 250 00 11, skype: medmedia.kz, e-mail: info@medmedia.kz
   
 
Яндекс.Метрика